Fully developed in house, Weistec's ECU tune. Mercedes Benz ECU tuning and calibration specialists3 Turbo Upgrade for M157 E63, E63S, S63, G63, CLS63, and CLS63S AMG vehicles. M157 Biturbo ECU Tune - RaceIQ Performance. Once these cars reach the 80,000 miles (ca. The options may be chosen on the product page Sale Items (M157/M278) Turbos (M157/M278) Cooling (M157/M278) Exhaust (M157/M278) Fuel (M157/M278) Ignition (M157/M278) Intake (M157/M278) Methanol and Nitrous (M157/M278) 9 TCU tune $ 1,900 VRP Street Valve body v2 $ 925 Sale! TCU Tune $ 499. Easy bolt-on installation. From choosing the right materials to finding a reliable contractor, there are countless decis. Whether you are an experienced yogi or trying for the first time— you have different types of yoga you ca. More power than the 991 Turbo, made easy. But what exactly is it? In this comprehensive review, we will take an in-depth look at K. Nov 2, 2016 · Weistec ecu tune review. Weistec Engineering offers True Downpipes for M157 AMG and M278 powered vehicles. Our upgrades support the 7G-DCT (724. The M157 is the second variant of the M278 and is tuned by Mercedes-AMG with a bore and stroke of 98 mm × 9086 in × 3. In our design, the cross-sectional area of the air box filter was increased by a massive 41%. michael holder Well pulled the trigger on getting my 45 tuned today from weistec and i thought i would share my opinion on the ecu tune with no other modifications. Plug in the module, flip the switch to Stock, wait for the green light, and done No sweat. Didn't see a thread for it. 00 Current price is: $495 Add to cart; Rapid TPM Module for M157 $ 749. As the global leader in Mercedes Benz AMG Tuning, Weistec Engineering sets the performance standard for bi-turbo M157 performance calibration. You need a four-string banjo and an e. This tune is also 100% street legal! 2012-2015 ML63 with M157 5 Through our non-invasive update to the powertrain control module (PCM), your AMG will produce 830 ft-lbs of torque! To put this in perspective, that's a 312 ft-lb gain! More importantly, power is dramatically increased throughout the engine's entire rpm range. Stage 1 M157 ML63 Performance Tune gains: Performance tuning modifies torque limiter maps, boost levels, fuel maps, ignition timing advance maps and more. Aftermarket Supercharger Tune (VRP Whipple) Yes I have installed an aftermarket supercharger (+$300 Boost your horsepower and torque with a tune specifically set to your modifications! Tuning software for the M113k AMG. 4 turbo kit comes in. With the combination of the RENNtech ECU Upgrade and the latest, 3rd generation Diverter. As the global leader in Mercedes Benz AMG Tuning, Weistec Engineering sets the performance standard for bi-turbo M157 performance calibration. 63 AMG ECU Tune (M157 / M278) $ 1,999 VRP550 Stage 1 Power Package (M113k) $ 1,60000 Select options. Black E63:M157 Stock turbosXoticpowerhaus TuneStock de-catted downpipesX-pipe in lieu of res. Our completely stock 2014 CLA45 AMG made 401HP and 363ft/lbs! Mercedes E63 W212 M157 ECU Tune $ 1,15000 Select options This product has multiple variants. C63 C63S S63 GLC63 G63 GT63 W205 W222 C217 A217 X253 C253 W463 X290 About Press Copyright Contact us Creators Advertise Developers Terms Privacy Policy & Safety How YouTube works Test new features NFL Sunday Ticket Press Copyright. This Brings your 63 AMG Up to date to where we think it should’ve been from the factory! This VRP Power Package will give you proven boost! Results for 63 AMG: 700HP / 775TQ. Increased Wheel Horsepower and Torque, on 91 octane with supporting upgrades. (Catless Application) Adds an approx. Our innovative throttle tuning system lets tune your engine's reactions to your taste - choose from 7 separate stages. 56 in) for use in higher-performance models. After months of painstaking dyno and road tuning, they are proud to introduce the most powerful ECU upgrade ever released for the M157 engine. microsoft outlook was not able to create a message with restricted permission Choose from Recommended Products (Optional) Transmission Pan Upgrade +$699 Torque Converter Upgrade +$3,399 Buy in monthly payments with Affirm on orders over $50. Includes Twin Turbo 5. The billet rods, which are of a. How freakish? ECU Tune CLA45 GLA45 A45 (M133) ECU tuning software for the 45 AMG. Factory emissions remain functional and are not disabled. The AMR Performance TCU software upgrade is the most advanced transmission tune on the market for supported Mercedes-Benz vehicles offering the latest in transmission control technology that can be programmed into your vehicle right from the comfort and ease of your own home. Mercedes Benz AMG ECU tuning, calibration, and performance experts. Improved exhaust note. After months of painstaking dyno and road tuning, we are proud to introduce the most powerful ECU upgrade ever released for the M157 engine. Our ECU tune offers the biggest performance gains on the market with our dyno results increasing performance from 556 HP and 544 lb/ft torque, up to an astonishing 669 HP and 734 lb/ft at the crank! This allows the CLS63 AMG to run the quarter mile on DT. Downpipes and Exhaust For Mercedes Benz AMG M157 CLS63 W218 RWD. Chip tuning from RaceChip for your Maserati Ghibli (M157) 3 Experience the true potential and power of your MASERATI. swtfreak This pulley upgrade offers excellent drivability and does not adversely affect highway mileage. Replacement air filter for the Alpha Mercedes-Benz AMG M157 / M278 Carbon Fiber Intake System. The RENNtech R1 Performance Package is the perfect entry level performance upgrade for the E 63 AMG. From our high performance reputation, to the retention of amenities expected. Engineered and designed with the most sophisticated Computer Aided Design tools, excellent fitment and the highest performance possible. Stainless steel heat shields offer the Weistec look and function. The first units which were fitted to the S 63 and CL 63 produced 536 hp (400 kW) and 590 lb-ft (800 Nm) of. More power than the 991 Turbo, made easy. Compatible with most all cars with the M157 engine: C63, E63, CLS63, CL63, ML63, GL63, GLE63, G63, S63 AMG Dyno tested Better throttle response Customized to your vehicle modifications Instant power gains Top speed governor removed Optimized timing and fueling maps Flash tune within the comfort VRP 2007+ 722 722. My goal is e50 tune, so i can get a. VRP Billet / Polyurethane Engine Mounts (M157) RWD $ 489 VRP Billet Cap for Trunk and Under Hood Tank $ 210 VRP Hoodie $ 30 VRP T-Shirt $ 16 VRP 2 Piece Pulley Set (M157/278) The Mercedes M177 engine is a twin-turbocharged, direct injection V-Eight gasoline engine. These headers fit the 63 AMG equipped with the M156 6.

5L BiTurbo (M157) Merecedes over time has revised spark plugs to one step colder on M278 and M157 according to Jason at OE Tuning. M157 V8 unfortunately did not get the same treatment because of the low volume and near end of its production cycle, and used silitec liners to the end of its lifecycle. Mercedes G63 M157 M177 W462/W463 ECU Tune $ 1,15000 Select options This product has multiple variants. Mercedes Benz AMG ECU tuning, calibration, and performance experts. The Alpha 9 Mercedes Benz 5. 5 liter M157 V8 AMG engine is a technological masterpiece, producing … RaceIQ Performance Tuning Calibrations fitted to Run on a Stock Car. As the global leader in Mercedes Benz AMG Tuning, Weistec Engineering sets the performance standard for bi-turbo M157 performance calibration. parlor donuts nutrition 30-40 additional Horsepower! Check the box below: Upgrade to Stage 2+$ 399 Product price. Every reprogramming is individually and tailor-made on our dyno and the results of the power and torque can also vary from car to car. This kind of philosophy allows to realize a specific tune for each customer, accord to the vehicle and the individual needs. 00 seconds SLR McLaren - 7. Premier Tuning Group. Performance M157 ECU tune for Mercedes Benz GL63 AMG X166 with M157 5. PTG │CP Carrillo M157 Forged Pistons & Rods99. dlnet login Quick discussion of why you ma. Do it right the first time, order your Alpha 5. 5L V8 BiTurbo; CLS-Class. 5L M157 AMG CUSTOM TUNE99. This is my first time using HP Tuners in general, although we have been tuning other platforms via COBB and EcuTek and Opensource for nearly a decade. sturm funeral home st james mn obituaries This … We examine M157 tuning and point out the premier modifications. The options may be chosen on the product page. Tuning Type: Stage 1 Stock TQ: 369 Tuned TQ: 406. As the global leader in Mercedes Benz AMG Tuning, Weistec Engineering sets the performance standard for bi-turbo M157 performance calibration. Your email address will not be published. Improved exhaust flow. BMW/MINI; Mercedes-Benz; Nissan; Porsche; Fiat; Hyundai VRP M157 / M278 Blow of valve / anti surge valve kit. R231 C217 W222 W221 C292 W166 X166 W463 W216 W218 W212 TCU tune for the Mercedes Benz AMG allows modification of torque management settings as well as faster shifting.

This tune is for Mercedes Benz E63 AMG W212 with M157 5. We can also customize your software easily for the mods on the car. Eurocharged ECU Tuning for your vehicle will unleash new power and a whole new driving experience. Through our non-invasive update to the powertrain control module (PCM), your AMG will produce 830 ft-lbs of torque! To put this in perspective, that's a 312 ft-lb gain! More importantly, power is dramatically increased throughout the engine's entire rpm range. Product Description. I have read a few of this ECUs and after seeing a few people asking for this files for this cars, I think most of this cars will be on one of this SW numbers, so one of this stock examples should do the trick. R231 C217 W222 W221 C292 W166 X166 W463 W216 W218 W212 $1,89920 Anti Surge Valve System, M157 M278 Non-SUV / ABC00 High Flow Air Filter Set, M157 / M27800. The tuning can be performed by simply using a remote control. If you have a newer AMG, you'll likely already be looking at performance modifications at some point. CDI - W212 - 2009 -> 2013. Fuel Reduction: N/A. The ECU tune is from pp performance. 00 Current price is: $495 Add to cart; Rapid TPM Module for M157 $ 749. Bolt-on installation. M273 ECU Tune $ 1,199 GFB DV+ T9388 $ 249 M157 Biturbo ECU Tune $ 1,29900 Select options This product has multiple variants. The stock HPFP on the M157 Motors is severely limited in capacity when trying to tune and raise the output of the motor. Mercedes E43 & E400 2017+ Stage 1 Performance ECU Tune (M276) E550. Mercedes G63 M157 M177 W462/W463 ECU Tune $ 1,15000 Select options This product has multiple variants. 56 in) for use in higher-performance models. Downpipes and Exhaust For Mercedes Benz AMG M157 G63 W463. This engine has been used in a variety of high-performance Mercedes-AMG models, such as the E63, S63, CLS63, and several others, primarily during the early to mid-2010s. M278 M157 Sealed Intake00. Playing a guitar with perfect tuning is essential for producing beautiful music. how to use tensorflow gpu The first units which were fitted to the S 63 and CL 63 produced 536 hp (400 kW) and 590 lb-ft (800 Nm) of. As an industry leader in tuning and calibration, Weistec Engineering is proud to introduce the much anticipated ECU tune for the bi-turbo M157 vehicle lineup. Spring is here, and it’s time to bring your bike out of its winter hibernation. RENNtech HHT (hand held tuner) allows you the unlimited ability to switch between tuned and stock ECU programming and requires no ECU removal! Our proprietary tuning module stores both the RENNtech tuned. EC is a well known AMG tuner based in the US that seems to go over and above when something's not right. Well pulled the trigger on getting my 45 tuned today from weistec and i thought i would share my opinion on the ecu tune with no other modifications. Hello all, I live in brazil, and started this week the process of learning and tunning my car. Buy in monthly payments with Affirm on orders over $50 Vehicle: Mercedes-Benz S63 AMG. Every reprogramming is individually and tailor-made on our dyno and the results of the power and torque can also vary from car to car. In today’s digital age, television entertainment has evolved to offer viewers a wide array of choices. Fully developed in house, Weistec's ECU tune. R231 C217 W222 W221 C292 W166 X166 W463 W216 W218 W212 Our intermediate level ECU upgrade for the Mercedes M157 Biturbo 4-MATIC engine offers huge gains in performance across the entire RPM range without sacrificing around town comfort or daily driver reliability. With thousands of songs available at our fingertips, it’s no wonder that many of us want to convert our favorite. It replaces the Mercedes-Benz M278 and M157 engines and is based on the Mercedes-AMG M133. Premier Tuning Group. M157 Mercedes V8 5. 0:1, compared with the M278's 10 The M157 engine is a twin-turbocharged 5. Pure M157 Upgrade Turbos. The car has Weistec w. This … G63 AMG M157 Stage 1 ECU Tune Performance Flash Gains: 122WHP @ 4000RPM Performance tuning modifies torque limiter maps, boost levels, … Performance software engineered for the 63 AMG to increase power and torque gains, improve fuel efficiency, delete lag, and much more! The Alpha 9 Mercedes Benz 5. The M157 is the second variant of the M278 and is tuned by Mercedes-AMG with a bore and stroke of 98 mm × 9086 in × 3. Our ECU tune offers the biggest performance gains on the market with our dyno results increasing performance from 556 HP and 544 lb/ft torque, up to an astonishing 669 HP and 734 lb/ft at the crank! This allows the CLS63 AMG to run the quarter mile on DT. If major servicing is necessary in addition to th. Factory emissions remain functional and are not disabled. final jeopardy world geography As an industry leader in tuning and calibration, Weistec Engineering is proud to introduce the much anticipated ECU tune for the bi-turbo M157 vehicle lineup. Reading ECU tune with an MPVI2 from HP Tuners. 4) transmissions, 7G MCT (722 This tune is specifically for our M156 3. As of March 16th 2015, Engine number start : 2789xx 30 266191, Mercedes change over to cast iron cylinder barrels. These camshafts are hard welded with a harder alloy than factory camshafts to prevent premature camshaft wear that plagues the m156 platform. The m157 ORF was PCR amplified by using purified viral DNA and the oligonucleotide primers m157-for1 (GAGGTGGCGTGTGAAACGCAG) and m157-rev1 (GTCAGTGAGATCGTGACC) based on the published sequence of the Smith MCMV strain. Tuning up a moped can increase. 6L V8 Biturbo engine provides excellent luxury class power for the 2011+ Mercedes-Benz lineup. Mercedes Benz AMG ECU tuning, calibration, and performance part experts. 00 Current price is: $495 Add to cart; Rapid TPM Module for M157 $ 749. Stage 1 Performance Tune greatly improves your performance by reflashing the ecu. Are you fascinated by the mysteries of the universe? Do you dream of exploring outer space and witnessing the wonders it has to offer? Thanks to NASA’s live streams, you can now ex. Designed in-house by our expert tuning staff, our M157 ECU tune has surpassed the 600 wheel horsepower mark on a completely stock vehicle with no other modifications. This kind of philosophy allows to realize a specific tune for each customer, accord to the vehicle and the individual needs. What does the kit include? Engine data comparison M156 - M157 8 Overview b Introduction of the New Generation of V-Engines, 8-cylinder M 157 AMG M 156 M 157 Cylinder configuration/angle V8/90° V8/90° Rated output at engine speed kW rpm 386 6800 400/4201) 5500 Rated torque at engine speed Nm rpm 630 5200 800/9001) 2500-3750 Displacement cm3 6208 5461 Bore mm 102 Alright ya'll!!!So theres been some chatter under some of the videos I've posted of the E63. Dyno B: Pump Gas - 797awhp & 910 awtq; STG2 Turbos; Tune; Downpipes As an industry leader in tuning and calibration, Weistec Engineering is proud to introduce the much anticipated ECU tune for the bi-turbo M157 vehicle lineup. Mercedes Benz AMG ECU tuning, calibration, and performance experts. (why it says 'internet') when doing a first read and something you have to do before able to read the ECU.